cDNA first-strand synthesis kit
Suitable for the synthesis of first-strand cDNA, cDNA library construction, SAGE (Serial Analysis of Gene Expression)
cDNA first-strand synthesis kit
One tube operation, 21 min to obtain high-quality cDNA without genomic DNA contamination. This kit contains a new and efficient gDNase, which can efficiently remove genomic DNA in 3 min, so that genomic DNA can be efficiently removed before transcription. Efficient reverse transcriptase, which can synthesize first-strand cDNA for fluorescence quantification experiments in just 15 min, with a reversal efficiency of up to 90%.
Price List
| Product No | Quantity | Price |
| 7306025 | 25 preps | contact us |
| 7306100 | 100 preps | contact us |
Introduction
One tube operation, 21 min to obtain high-quality cDNA without genomic DNA contamination. This kit contains a new and efficient gDNase, which can efficiently remove genomic DNA in 3 min, so that genomic DNA can be efficiently removed before transcription. Efficient reverse transcriptase, which can synthesize first-strand cDNA for fluorescence quantification experiments in just 15 min, with a reversal efficiency of up to 90%.
Storage
This kit can be transported at low temperature, stored at -20℃ for more than 2 years.
Experimental Data
Figure 1: The image on the right shows the same initial amount of rat RNA of 1 μg each, reverse transcribed with cDNA kits from different companies, diluted 10-fold, and 5 μl used as PCR template for fluorescent PCR.
PCR primer: Rat β-actin Internal control primers
Forward：CCCATCTATGAGGGTTACGC
Reverse：TTTAATGTCACGCACGATTTC
