2×One Step Probe RT-qPCR Mix
Suitable for mRNA expression analysis and detection of trace RNA.
2×One Step Probe RT-qPCR Mix
2×One Step Probe RT-qPCR Mix is a two-fold concentration master mix dedicated to probe-based real-time PCR. One-step Real Time RT-PCR with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. For experiments, RT-qPCR reactions can be easily prepared by taking 0.5 times the volume of the PCR system with 2×One Step Probe RT-qPCR Mix, adding primers, probes, RT-Taq enzyme mix, and RNA template, and making up the volume with RNase-free water. It is suitable for use in Applied Biosystems, Bio-Rad, Eppendorf, Roche and other mainstream fluorescence PCR instruments in the market.
Price list
| Cat. No. | specification | Price |
| 7406100 | 1 ml | contact us |
| 7406500 | 5 ml | contact us |
Introduction
2×One Step Probe RT-qPCR Mix is a two-fold concentration master mix dedicated to probe-based real-time PCR. One-step Real Time RT-PCR with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. For experiments, RT-qPCR reactions can be easily prepared by taking 0.5 times the volume of the PCR system with 2×One Step Probe RT-qPCR Mix, adding primers, probes, RT-Taq enzyme mix, and RNA template, and making up the volume with RNase-free water. It is suitable for use in Applied Biosystems, Bio-Rad, Eppendorf, Roche and other mainstream fluorescence PCR instruments in the market.
Storage
It can be transported at low temperature and stored at -20℃ for more than 2 years.
Experimental Data

Figure 1: Amplification plot of COVID-19 RNA extracted from a throat swab sample (at a concentration of approximately 1×10⁷ copies/ml) diluted in different folds and amplified by 2×One Step Probe RT-qPCR Mix. (From left to right, viral RNA amplification curves for undiluted, 10-fold, 100-fold, 1000-fold, 10,000-fold, and 100,000-fold diluted)
COVID-19 primers and probes:
Forward: CCCTGTGGGTTTTACACTTAA;
Reverse: ACGATTGTGCATCAGCTGA;
Probe: 5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′
Composition(Cat.No.7406100)
Store at -20°C
| 2×One Step Probe RT-qPCR Mix | 1 ml |
| RT-Taq enzyme mixture | 80 μL |
| 50×ROX Reference Dye | 40 μL |
| RNase-free Water | 1 ml |







