2×One Step Probe RT-qPCR Mix

Suitable for mRNA expression analysis and detection of trace RNA.

2×One Step Probe RT-qPCR Mix

2×One Step Probe RT-qPCR Mix is a two-fold concentration master mix dedicated to probe-based real-time PCR. One-step Real Time RT-PCR with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. For experiments, RT-qPCR reactions can be easily prepared by taking 0.5 times the volume of the PCR system with 2×One Step Probe RT-qPCR Mix, adding primers, probes, RT-Taq enzyme mix, and RNA template, and making up the volume with RNase-free water. It is suitable for use in Applied Biosystems, Bio-Rad, Eppendorf, Roche and other mainstream fluorescence PCR instruments in the market.

Price list

Cat. No. specification Price
7406100 1 ml contact us
7406500 5 ml contact us

Introduction

2×One Step Probe RT-qPCR Mix is a two-fold concentration master mix dedicated to probe-based real-time PCR. One-step Real Time RT-PCR with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. For experiments, RT-qPCR reactions can be easily prepared by taking 0.5 times the volume of the PCR system with 2×One Step Probe RT-qPCR Mix, adding primers, probes, RT-Taq enzyme mix, and RNA template, and making up the volume with RNase-free water. It is suitable for use in Applied Biosystems, Bio-Rad, Eppendorf, Roche and other mainstream fluorescence PCR instruments in the market.

Storage

It can be transported at low temperature and stored at -20℃ for more than 2 years.

Experimental Data

Figure 1: Amplification plot of COVID-19 RNA extracted from a throat swab sample (at a concentration of approximately 1×10⁷ copies/ml) diluted in different folds and amplified by 2×One Step Probe RT-qPCR Mix. (From left to right, viral RNA amplification curves for undiluted, 10-fold, 100-fold, 1000-fold, 10,000-fold, and 100,000-fold diluted)

COVID-19 primers and probes:

Forward: CCCTGTGGGTTTTACACTTAA;

Reverse: ACGATTGTGCATCAGCTGA;

Probe: 5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′

 

Composition(Cat.No.7406100)

Store at -20°C

2×One Step Probe RT-qPCR Mix 1 ml
RT-Taq enzyme mixture 80 μL
50×ROX Reference Dye 40 μL
RNase-free Water 1 ml

Resources

Thesis

Scroll to Top