2×GC-Rich PCR Mix
Suitable for PCR amplification of high GC fragments, various markers of DNA and gene scanning based on PCR technology.
2×GC-Rich PCR Mix
2×GC-Rich PCR Mix is an optimized two-fold concentration PCR master mix. Suitable for PCR amplification with high fidelity requirements, long amplification fragments and high GC content. The specially formulated GC-Rich Buffer amplifies DNA fragments up to 81% GC and up to 10 kb in length. The product is easy to use, only need to take 0.5 times the volume of the PCR system 2× GC-Rich PCR Mix and appropriate GC-Rich Buffer, add primers and template, and make up the volume with ddH2O. Most of the target products amplified by 2×GC-Rich PCR Mix have an Adenine base attached to the 3′ end and can be cloned directly in T-Vector.
Price list
| Cat. No. | specification | Price |
| 7006100 | 1 ml | contact us |
| 7006500 | 5 ml | contact us |
Introduction
2×GC-Rich PCR Mix is an optimized two-fold concentration PCR master mix. Suitable for PCR amplification with high fidelity requirements, long amplification fragments and high GC content. The specially formulated GC-Rich Buffer amplifies DNA fragments up to 81% GC and up to 10 kb in length. The product is easy to use, only need to take 0.5 times the volume of the PCR system 2× GC-Rich PCR Mix and appropriate GC-Rich Buffer, add primers and template, and make up the volume with ddH2O. Most of the target products amplified by 2×GC-Rich PCR Mix have an Adenine base attached to the 3′ end and can be cloned directly in T-Vector.
Storage
It can be transported at low temperature and stored at -20℃ for more than 2 years.
Experiment examples:
Figure 1: Electrophoresis plot of PCR product.
Primer: Forward: CTCGCAGGTAATTATTGCCAG
Reverse: GATGGACGCACCCTTG
(Human Klotho gene, 81%GC fragment contented)
Composition(Cat.No.7006100)
-20℃ storage
| 2×GC-Rich PCR Mix | 1 ml | |
| GC-Rich Buffer | 0.5 ml | |
| ddH2O | 1 ml |
