FFPE Tissue DNA Extraction Kit
Suitable for extracting total DNA from 3-8 tissue sections (less than 250 mm2) of 10 μm FFPE (formalin-fixed, paraffin-embedded).
FFPE Tissue DNA Extraction Kit
- Suitable for FFPEsamples.
- Simultaneous extraction of mitochondrial DNA and possible viral DNA from tissue sections.
- Specially spin columns ensure efficient adsorption of highly degraded DNA.
Price List
| Product No | Quantity | Price |
| 4400050 | 50 preps | contact us |
| 4400250 | 250 preps | contact us |
Description
After xylene dissolves paraffin, then the FFPE tissue digested by proteinase K to release DNA, the column purification technology completely removes the impurities and PCR inhibitors remaining on the spin column, and the DNA eluted with Buffer TE can be immediately used in various molecular biology experiments.
Specifications
Applications: PCR, pharmacogenomics research.
Sample: Paraffin tissue sections
Sample amount: 3-8 (less than 250 mm2) 10 μm tissue sections
Column binding capacity: up to 20 μg total DNA.
Instruments required: A high-speed centrifuge with rotor for 2 ml tubes.
Experimental date
Figure 1: Extracted DNA from PPFE tissue (1-4 for the same sample) using the Simgen PPFE DNA Extraction Kit, M: 1 kb DNA Ladder.
Figure 2: The extracted FFPE tissue DNA was used as a template for amplification by human actin primers （Forward: CTCCATCCTGGCCTCGCTGT, Reverse: GCTGTCACCTTCACCGTTCC, fragment is approximately 270 bp）. M: Simgen 50bp DNA Ladder. 1-4: Amplification plot of extracted FFPE tissue DNA as a template. 5: negative control. 6: Positive control using human genomic DNA as a template.
Specifications
