2×One Step SYBR Green RT-qPCR Mix
This product is a special reagent for one step RT-qPCR using the SYBR Green I chimeric fluorescence method.
2×One Step SYBR Green RT-qPCR Mix
Real-Time RT-qPCR reactions with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. This reaction system can detect the amplified products in real time, which greatly improves the detection sensitivity, and omits the electrophoresis step after the PCR reaction, which is very suitable for the detection of trace RNA.
Reverse transcriptase suitable for Real Time RT-qPCR and Taq enzyme with high amplification efficiency and high amplification specificity are used in this product, which can perform stable Real Time One Step RT-qPCR reactions.
Price List
| Cat. No. | specification | Price |
| 7405100 | 1 ml | contact us |
| 7405500 | 5 ml | contact us |
Introduction
Real-Time RT-qPCR reactions with this product can be performed continuously in the same reaction tube, which is simple to operate and can effectively prevent contamination. This reaction system can detect the amplified products in real time, which greatly improves the detection sensitivity, and omits the electrophoresis step after the PCR reaction, which is very suitable for the detection of trace RNA.
Reverse transcriptase suitable for Real Time RT-qPCR and Taq enzyme with high amplification efficiency and high amplification specificity are used in this product, which can perform stable Real Time One Step RT-qPCR reactions.
Storage
It can be transported at low temperature and stored at -20℃ for more than two years.
Experimental Data
The PCR system is configured according to the following components
| Component | volume | Final concentration |
| 2×One Step SYBR Green RT-qPCR Mix | 25 μL | 1× |
| RT-qPCR Mix | ||
| RT-qPCR Enzyme Mix | 1 μl | |
| Forward primer (10 μM) | 1 μl | 0.20 µM |
| Reverse primer (10 μM) | 1 μl | 0.20 µM |
| 50× ROX Reference Dye | 1 μl | |
| RNA template | — | |
| RNase-free Water | to 50 μl |
Figure 1: amplification plot of the extracted potato RNA, which were diluted 10-fold, 100-fold, 1000-fold, and 10000-fold, respectively, and amplified by Simgen
2×One Step SYBR Green RT-qPCR Mix.
Primers: Potato EF1A internal control primers
Forward：ATTGGAAACGGATATGCTCCA
Reverse：TCCTTACCTGAACGCCTGTCA
It is recommended to use the standard PCR reaction procedure shown in the chart below. If the procedure does not result in good results, PCR conditions should be optimized.
| circulate | steps | temperature | Time | content |
| 1× | 1 | 50℃ | 5 min | reverse transcription |
| 2 | 95℃ | 10 sec | ||
| 40× | 3 | 95℃ | 5 sec | PCR reactions |
| 4 | 60℃ | 30 sec | ||
| 1× | 5 | 95℃ | 15 sec | Dissociation Protocol |
| 6 | 60℃ | 1 min | ||
| 7 | 95℃ | 15 sec |
Composition（Cat.No.7405100）
Store at -20°C
| 2×One Step SYBR Green RT-qPCR Mix | 1 ml |
| RT-qPCR Enzyme Mix | 40 μL |
| 50×ROX Reference Dye | 40 μL |
| RNase-free Water | 1 ml |
